image_151

Fusobacterium nucleatum Alters Atherosclerosis Risk Factors and Enhances Inflammatory Markers with an Atheroprotective Immune Response in ApoE(null) Mice.

RSS de esta página

PubMed ID: 26079509

Imagen Publicación

Velsko IM, Chukkapalli SS, Rivera-Kweh MF, Chen H, Zheng D, Bhattacharyya I, Gangula PR, Lucas AR, Kesavalu L

PLoS One. 2015. doi: 10.1371/journal.pone.0129795

COMMENT: It is known (and supported by The American Heart Association) that exists an association between periodontal disease (PD) and atherosclerotic vascular disease (ASVD). 

In this case the ApoEnull hyperlipidemic mice used as model in ASVD studies was infected with Fusobacterium nucleatum to analyze the influence of this infection in aortic atherosclerotic lesions. Fusobacterium nucleatum specific PCR was performed on both oral samples and systemic organ samples with these 16S rDNA F. nucleatum specific primers: forward 5’- TAAAGCGCGTCTAGGTGGTT -3’, reverse 5’- ACAGCTTTGC GACTCTCTGT -3’.

Despite the authors had described that, the also periodontal pathogens, Porphyromonas gingivalis and Treponema denticola were causally associated with acceleration of aortic atherosclerosis, in this case, aortic atherosclerotic lesions were significantly reduced after Fusobacterium nucleatum infection ( with evidence for systemic infection in several organs). This finding open the posiibility of a potential protective function for some members of the oral microbiota that could be applied in ASVD for preventive treatments.

+ info

Contributor

Raquel Tobes