image_241

16S Primers

Universal 16S primers

PRIMER: 8F
SEQUENCE (5´--> 3´): AGAGTTTGATCCTGGCTCAG
SEQUENCE (5´--> 3´) FORWARD STRAND: AGAGTTTGATCCTGGCTCAG
INITIAL: 8
FINAL : 27
TARGET: Universal
REFERENCE: Turner et al. 1999 


PRIMER: 27F
SEQUENCE (5´--> 3´): AGAGTTTGATCMTGGCTCAG
SEQUENCE (5´--> 3´) FORWARD STRAND: AGAGTTTGATCMTGGCTCAG
INITIAL: 8
FINAL : 27
TARGET: Universal
REFERENCE: Lane, D.J. 1991. 16S/23S rRNA sequencing. In: Nucleic acid techniques in bacterial systematics. Stackebrandt, E., and Goodfellow, M., eds., John Wiley and Sons, New York, NY, pp. 115-175.


PRIMER: CC [F]
SEQUENCE (5´--> 3´): CCAGACTCCTACGGGAGGCAGC
SEQUENCE (5´--> 3´) FORWARD STRAND: CCAGACTCCTACGGGAGGCAGC
INITIAL: 334
FINAL : 355
TARGET: Universal
REFERENCE: Rudi et al. 1997


PRIMER: 357F
SEQUENCE (5´--> 3´): CTCCTACGGGAGGCAGCAG
SEQUENCE (5´--> 3´) FORWARD STRAND: CTCCTACGGGAGGCAGCAG
INITIAL: 339
FINAL : 357
TARGET: Universal
REFERENCE: Turner et al. 1999 


PRIMER: 515F
SEQUENCE (5´--> 3´): GTGCCAGCMGCCGCGGTAA
SEQUENCE (5´--> 3´) FORWARD STRAND: GTGCCAGCMGCCGCGGTAA
INITIAL: 515
FINAL : 533  
TARGET: Universal
REFERENCE: Turner et al. 1999


PRIMER: 533F
SEQUENCE (5´--> 3´): GTGCCAGCAGCCGCGGTAA
SEQUENCE (5´--> 3´) FORWARD STRAND: GTGCCAGCAGCCGCGGTAA
INITIAL: 515
FINAL : 533
TARGET: Universal
REFERENCE: Weisburg et al. 1991


PRIMER: 16S.1100.F16
SEQUENCE (5´--> 3´): CAACGAGCGCAACCCT
SEQUENCE (5´--> 3´) FORWARD STRAND: CAACGAGCGCAACCCT
INITIAL: 1100
FINAL : 1115
TARGET: Universal
REFERENCE: Turner et al. 1999


PRIMER: 1237F
SEQUENCE (5´--> 3´): GGGCTACACACGYGCWAC
SEQUENCE (5´--> 3´) FORWARD STRAND: GGGCTACACACGYGCWAC
INITIAL: 1220
FINAL : 1237
TARGET: Universal
REFERENCE: Turnet et al. 1999


PRIMER: 519R
SEQUENCE (5´--> 3´): GWATTACCGCGGCKGCTG
SEQUENCE (5´--> 3´) FORWARD STRAND: CAGCMGCCGCGGTAATWC
INITIAL: 519
FINAL : 536
TARGET: Universal
REFERENCE: Turner et al. 1999


PRIMER: CD [R]
SEQUENCE (5´--> 3´): CTTGTGCGGGCCCCCGTCAATTC
SEQUENCE (5´--> 3´) FORWARD STRAND: GAATTGACGGGGGCCCGCACAAG
INITIAL: 917
FINAL : 939
TARGET: Universal
REFERENCE: Rudi et al. 1997


PRIMER: 907R
SEQUENCE (5´--> 3´): CCGTCAATTCMTTTRAGTTT
SEQUENCE (5´--> 3´) FORWARD STRAND: AAACTYAAAKGAATTGACGG
INITIAL: 907
FINAL : 926
TARGET: Universal
REFERENCE: Lane, D.J. 1991. 16S/23S rRNA sequencing. In: Nucleic acid techniques in bacterial systematics. Stackebrandt, E., and Goodfellow, M., eds., John Wiley and Sons, New York, NY, pp. 115-175.


PRIMER: 1100R
SEQUENCE (5´--> 3´): AGGGTTGCGCTCGTTG
SEQUENCE (5´--> 3´) FORWARD STRAND: CAACGAGCGCAACCCT  
INITIAL: 1100
FINAL : 1115
TARGET: Bacteria
REFERENCE: Turner et al. 1999


PRIMER: 1391R
SEQUENCE (5´--> 3´): GACGGGCGGTGTGTRCA
SEQUENCE (5´--> 3´) FORWARD STRAND: TGYACACACCGCCCGTC
INITIAL: 1391
FINAL : 1407
TARGET: Universal
REFERENCE: Turner et al. 1991

PRIMER: 1492R (l)
SEQUENCE (5´--> 3´): GGTTACCTTGTTACGACTT
SEQUENCE (5´--> 3´) FORWARD STRAND: AAGTCGTAACAAGGTAACC
INITIAL: 1492
FINAL : 1510
TARGET: Universal
REFERENCE: Turner et al. 1991


PRIMER: 1492R (s)
SEQUENCE (5´--> 3´): ACCTTGTTACGACTT
SEQUENCE (5´--> 3´) FORWARD STRAND: AAGTCGTAACAAGGT
INITIAL: 1492
FINAL : 1506
TARGET: Universal
REFERENCE: Lane, D.J. 1991. 16S/23S rRNA sequencing. In: Nucleic acid techniques in bacterial systematics. Stackebrandt, E., and Goodfellow, M., eds., John Wiley and Sons, New York, NY, pp. 115-175.

IUPAC nucleotide code

IUPAC nucleotide code
  • R: A or G

  • Y: C or T

  • S: G or C

  • W: A or T

  • K: G or T

  • M: A or C

  • B: C or G or T

  • D: A or G or T

  • H: A or C or T

  • V: A or C or G

  • N: any base

  • . or -: gap

RSS de esta página